Jupiter's Daughter by Tom Hyman
Author:Tom Hyman [Hyman, Tom]
Format: epub, pdf
Tags: Science fiction, General, Fiction, Horror - General, Twenty-first century, Literary, Genetic engineering, Mothers and daughters, Psychological, Fiction - Psychological Suspense
ISBN: 9780451406248
Publisher: Onyx
Published: 1995-08-31T23:00:00+00:00
ACCTCAGACTGTCTTCACGGTCTAGTCGATCGATCG
ACCTCAGACGGAACGCACGGTCTAGTCGATCGATCG
ACCTCAGACCTCCAACACGGTCTAGTCGATCGATCG Anne sat back on her heels. "I see the difference. Is that all there is on all these pages? Just endless rows of A's, C's, T's, and G's?"
"Yup. That's all."
"What can it possibly tell you?"
"Just about everything. It's a complete set of instructions for building a human being."
Anne expressed amazement. "How many pages would there be if you printed out the whole thing?"
Elder scratched his chin. "I don't know. Hundreds, I guess."
"Well, why only four letters?"
"The letters stand for four different nucleotides--adenine, guanine, cytosine, and thymine. They make up the billions of base pairs that form the double strand of the DNA molecule."
Anne frowned. "I should know that, shouldn't I? I mean, I majored in biology, after all. But genetics wasn't emphasized that much. Gregor Mendel and his pea plants is about all I remember."
"Biology has come a long way since you were in college-which couldn't have been very long ago."
Anne flushed. It was the first time Elder had ever made any direct comment about her. Was he being complimentary or condescending? "Is it too late for me to catch up?"
"Of course not. The basic concepts haven't changed. But there's been enormous progress--new discoveries, new terminologies, new techniques.
I'm not very current in the field myself. It'd be a full-time job just keeping abreast of it all."
"Will you . . . could you just review some of the basics for me?" It was unlike her to make demands like this on anyone. The impulse surprised her, but she didn't back away from it.
"You might find it tedious."
"No, no. I sure I won't."
1
.
Elder scratched his chin again. "Well, where to begin? Maybe a quick, simplified overview. Every cell in the human body contains a command center of sorts, a nucleus. You probably remember that from--' "I don't think blood cells have nuclei," Anne interrupted. Elder nodded hastily. "That's right. Blood cells don't. But most others do. Anyway, inside each nucleus there are chromosomes-little wormlike clusters of specialized molecules made up of deoxyribonucleic acid, or DNA. We have forty-six of these chromosomes altogether. Everybody's are the same, except males have an X and a Y chromosome, females two X's. These forty-six chromosomes carry all the human genes. And we still haven't found them all. The latest count puts the number at over 150,000. And these genes are not separate entities--they're really just special stretches of DNA code on the chromosomes, each assigned to perform a specific function. No, correct that--each carrying its own set of directions for how to assemble and operate a specific part of the human body. Taken together, the genes make up what we call the human genome. They contain both the blueprint and all the operating instructions for a human being." Elder picked up the textbook Anne had been reading and found a page showing a diagram of the DNA molecule.
"Each chromosome consists of two extremely long and extremely thin parallel strands of DNA. The strands don't lie straight. Imagine a long rope ladder twisted in a clockwise
Download
This site does not store any files on its server. We only index and link to content provided by other sites. Please contact the content providers to delete copyright contents if any and email us, we'll remove relevant links or contents immediately.
Beautiful Disaster by McGuire Jamie(25317)
Trainspotting by Irvine Welsh(21631)
Call Me by Your Name by André Aciman(20482)
The Secret History by Donna Tartt(19023)
All the Missing Girls by Megan Miranda(15921)
Cat's cradle by Kurt Vonnegut(15324)
Pimp by Iceberg Slim(14476)
Norse Mythology by Gaiman Neil(13331)
The Tidewater Tales by John Barth(12643)
4 3 2 1: A Novel by Paul Auster(12362)
Scorched Eggs by Childs Laura(11341)
The Break by Marian Keyes(9357)
The remains of the day by Kazuo Ishiguro(8965)
Adultolescence by Gabbie Hanna(8908)
Never let me go by Kazuo Ishiguro(8865)
Where the Crawdads Sing by Delia Owens(8598)
All the Light We Cannot See: A Novel by Anthony Doerr(8479)
A Man Called Ove: A Novel by Fredrik Backman(8423)
Circe by Madeline Miller(8120)