The Forgetting River: A Modern Tale of Survival, Identity, and the Inquisition

Author:Doreen Carvajal
Language: eng
Format: mobi
Tags: Non-Fiction, Religion, History
ISBN: 9781101596814
Publisher: Penguin
Published: 2012-08-16T00:00:00+00:00

Pruning the Tree

08

09

10

11

12

13

14

Arcos de la Frontera, 2008 15

16

The DNA kit was delivered in a small brown envelope with 17

three little swabs, liquid storage vials, and primitive how18

to line drawings with the look of illustrations from a 1950s 19

technical manual. The swabs were used to scrape the inner 20

lining of the cheek to collect cell samples for testing and they 21

were then packed in the vials for return to a Texas-based test22

ing company, Family Tree DNA. 23

It had not taken much urging to persuade my father to 24

take the test, though my first e-mail with my strange request 25

was initially ignored. But eventually my father agreed and 26

I ordered a DNA kit to be sent to him. I also scraped my S27

own samples, but it would give information only about my N28

01 maternal lines. I asked my father to join me because his DNA 02 sample would reveal his maternal and paternal lines, which 03 might offer clues to track distant relatives and lost branches 04 of the family tree.

05 The advantage of the testing is that it can tell you if two 06 individual men share a common male ancestor or whether 07 there are connections to others with similar-sounding sur08 names. The disadvantage is unexpected information: relatives 09 who don’t match, hidden adoptions, false paternities—bends 10 in the river of ancestors. The ultimate surprise is if there are 11 no matches—an ancestral black hole of nothingness. 12 “The DYS markers are short tandem repeats, sequences 13 of DNA that consist of repetitions of a short motif— 14 GATAGATAGATAGATAGATA—and so on. They are found 15 throughout the genome, and they vary from individual to 16 individual in the number of times they are repeated. That’s 17 what the numbers in the results are. They mutate quite fast: 18 they can add or subtract one unit once every five hundred 19 father-son transmissions,” Francesc Calafell, the Barcelona 20 geneticist, told me.

21 When my father’s results arrived from Family Tree—sent 22 by e-mail from California to Spain—I was baffled by mysteri23 ous codes within a series of twelve numbers. His initial test 24 revealed that his haplogroup is a G, which quick research 25 revealed originated in India or Pakistan dispersing to Central 26 Asia, Europe, and the Middle East. Its G2 branch was com27S monly found in Europe or the Middle East. When I checked 28N

Francesc’s study sample of Sephardic Jews I saw that it is dom01

inated by three haplogroups, J1, J2, and my father’s type, G. 02

Some families have used these genetic clues to resolve 03

family mysteries or confirm legends passed through genera04

tions. Descendants of Thomas Jefferson, the third president 05

of the United States, verified stories that they were most likely 06

descendants of Jefferson and his slave, Sally Hemings, ulti07

mately through DNA testing in 1998 and 2001 by comparing 08

Y chromosomes. The paternity, which couldn’t be established 09

with certainty, showed strong evidence that Jefferson fathered 10

her children. Further research showed that the Jefferson line 11

was K2—or now a T haplotype. It is rare in Europe, more 12

common in people of the Middle East and Africa.

Download

Copyright Disclaimer:
This site does not store any files on its server. We only index and link to content provided by other sites. Please contact the content providers to delete copyright contents if any and email us, we'll remove relevant links or contents immediately.