Search results for "python"
epub, pdf |eng | 2021-05-25 | Author:Wes McKinney [Wes McKinney]
In [3]: b = [1, 2, 3] In [4]: b.<Tab> b.append b.count b.insert b.reverse b.clear b.extend b.pop b.sort b.copy b.index b.remove The same is true for modules: In [1]: import ...
( Category:
other
June 4,2021 )
pdf | | 2021-03-30 | Author:Mark Liu
( Category:
other
June 3,2021 )
pdf | | 2021-02-18 | Author:Ahmed Fawzy Gad
( Category:
other
June 3,2021 )
pdf | | | Author:Brian Overland
( Category:
other
June 3,2021 )
pdf | | 2020-05-23 | Author:James Herron [Herron, James]
( Category:
other
June 1,2021 )
pdf | | 2021-05-07 | Author:Unknown
( Category:
other
May 31,2021 )
pdf | | 2021-04-16 | Author:Unknown
( Category:
other
May 30,2021 )
pdf | | | Author:Unknown
( Category:
other
May 30,2021 )
pdf | | | Author:Unknown
( Category:
other
May 29,2021 )
pdf |en | | Author: Therese Hardin; Mathieu Jaume; Francois Pessaux; Veronique Viguie Donzeau-Gouge
( Category:
other
May 29,2021 )
epub |eng | 2021-07-24 | Author:Ken Youens-Clark [Ken Youens-Clark]
>>> rna = 'AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA' >>> aa = [] >>> for codon in [rna[n:n + 3] for n in range(0, len(rna), 3)]: ... aa.append(codon_to_aa[codon]) ... >>> aa ['M', 'A', 'M', 'A', ...
( Category:
other
May 28,2021 )
pdf | | 2021-05-23 | Author:Jason Test & Mark Broker [Test, Jason]
( Category:
other
May 27,2021 )
epub |eng | | Author:Brendan Choi
( Category:
Programming Languages
May 27,2021 )
epub |eng | | Author:Gayathri Rajagopalan
pd.Timestamp('25 December 2000') pd.Timestamp('December 25 2000') pd.Timestamp('12/25/2000') pd.Timestamp('25-12-2000') pd.Timestamp(year=2000,month=12,day=25) pd.Timestamp('25-12-2000 12 PM') pd.Timestamp('25-12-2000 0:0.0') The pd.Timestamp function helps us define a date, time, and a combination of these two. However, ...
( Category:
other
May 27,2021 )
epub |eng | 2019-02-27 | Author:Fabrizio Romano [Fabrizio Romano]
( Category:
Python Programming
May 27,2021 )
Hot search:
OCP Java SE 7 Programmer II Certification Guide First-Party Data Activation Netty in Action Manning cookbook Atomic Habits by James Clear python vampire adam Star trek Erotica History of elle kennedy z daddy Stories M"žu?index=10/ Elle Kennedy M"žu?index=2/ M"žu?index=9/ .2 AI M"žu?index=5/ box set the very secret society of irregular witches tales donald collection bible rachel communication h {searchTerms} kent M"žu?index=7/ variation fix Complete Box set HTTPS monster pattern harry potter Artificial intelligence wonder litrpg dungeon crawler carl Ghost easy nation transformations
OCP Java SE 7 Programmer II Certification Guide First-Party Data Activation Netty in Action Manning cookbook Atomic Habits by James Clear python vampire adam Star trek Erotica History of elle kennedy z daddy Stories M"žu?index=10/ Elle Kennedy M"žu?index=2/ M"žu?index=9/ .2 AI M"žu?index=5/ box set the very secret society of irregular witches tales donald collection bible rachel communication h {searchTerms} kent M"žu?index=7/ variation fix Complete Box set HTTPS monster pattern harry potter Artificial intelligence wonder litrpg dungeon crawler carl Ghost easy nation transformations
Categories
Popular ebooks