Search results for "python"
epub |eng | 2021-07-24 | Author:Ken Youens-Clark [Ken Youens-Clark]

>>> rna = 'AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA' >>> aa = [] >>> for codon in [rna[n:n + 3] for n in range(0, len(rna), 3)]: ... aa.append(codon_to_aa[codon]) ... >>> aa ['M', 'A', 'M', 'A', ...
( Category: other May 28,2021 )
epub |eng | | Author:Brendan Choi

( Category: Programming Languages May 27,2021 )
epub |eng | | Author:Gayathri Rajagopalan

pd.Timestamp('25 December 2000') pd.Timestamp('December 25 2000') pd.Timestamp('12/25/2000') pd.Timestamp('25-12-2000') pd.Timestamp(year=2000,month=12,day=25) pd.Timestamp('25-12-2000 12 PM') pd.Timestamp('25-12-2000 0:0.0') The pd.Timestamp function helps us define a date, time, and a combination of these two. However, ...
( Category: other May 27,2021 )
epub |eng | 2019-02-27 | Author:Fabrizio Romano [Fabrizio Romano]

( Category: Python Programming May 27,2021 )
pdf | | 2015-10-23 | Author:Unknown

( Category: other May 26,2021 )
pdf | | | Author:Unknown

( Category: other May 26,2021 )
pdf | | 2020-05-04 | Author:800+ pages of professional hints & tricks

( Category: other May 24,2021 )
pdf | | | Author:Unknown

( Category: other May 23,2021 )
pdf | | 0101-01-01 | Author:Zamzar

( Category: other May 22,2021 )
epub |eng | 2021-05-15 | Author:Swati Saxena [Saxena, Swati]

What is PyCharm and wxPython?/p> Ans. Pycharm is an editor and integrated development environment by Jetbrains.com. Wxpython is a GUI library used for making GUI apps written in Python/C++. List ...
( Category: Internet & Social Media May 22,2021 )
pdf | | 2021-03-09 | Author:Campesato, Oswald;

( Category: other May 21,2021 )