Search results for "python"
pdf |en | | Author: Therese Hardin; Mathieu Jaume; Francois Pessaux; Veronique Viguie Donzeau-Gouge
( Category:
other
May 29,2021 )
epub |eng | 2021-07-24 | Author:Ken Youens-Clark [Ken Youens-Clark]
>>> rna = 'AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA' >>> aa = [] >>> for codon in [rna[n:n + 3] for n in range(0, len(rna), 3)]: ... aa.append(codon_to_aa[codon]) ... >>> aa ['M', 'A', 'M', 'A', ...
( Category:
other
May 28,2021 )
epub |eng | | Author:Gayathri Rajagopalan
pd.Timestamp('25 December 2000') pd.Timestamp('December 25 2000') pd.Timestamp('12/25/2000') pd.Timestamp('25-12-2000') pd.Timestamp(year=2000,month=12,day=25) pd.Timestamp('25-12-2000 12 PM') pd.Timestamp('25-12-2000 0:0.0') The pd.Timestamp function helps us define a date, time, and a combination of these two. However, ...
( Category:
other
May 27,2021 )
epub |eng | 2019-02-27 | Author:Fabrizio Romano [Fabrizio Romano]
( Category:
Python Programming
May 27,2021 )
pdf | | 2020-05-04 | Author:800+ pages of professional hints & tricks
( Category:
other
May 24,2021 )
epub |eng | 2021-05-15 | Author:Swati Saxena [Saxena, Swati]
What is PyCharm and wxPython?/p> Ans. Pycharm is an editor and integrated development environment by Jetbrains.com. Wxpython is a GUI library used for making GUI apps written in Python/C++. List ...
( Category:
Internet & Social Media
May 22,2021 )
Hot search:
Atomic Habits by James Clear Erotic vampire Erotica Taboo harry potter the secret lesbian The 48 Laws of Power by Robert Greene project hail mary the very secret society of irregular witches cookbook business Chris Box set Daddy python Dummies Lesbian stephen king novella adam 2025 chess music atomic habits Family soa JOB Black erotic litrpg collection History of Rich Dad, Poor Dad by Robert T. Kiyosaki magazine dune evaluation lunar chronicles 1984 dummies cuckold Freida McFadden dungeon crawler carl architecture freida mcfadden Robin Omnibus japanese history
Atomic Habits by James Clear Erotic vampire Erotica Taboo harry potter the secret lesbian The 48 Laws of Power by Robert Greene project hail mary the very secret society of irregular witches cookbook business Chris Box set Daddy python Dummies Lesbian stephen king novella adam 2025 chess music atomic habits Family soa JOB Black erotic litrpg collection History of Rich Dad, Poor Dad by Robert T. Kiyosaki magazine dune evaluation lunar chronicles 1984 dummies cuckold Freida McFadden dungeon crawler carl architecture freida mcfadden Robin Omnibus japanese history
Categories
Popular ebooks
