Search results for "python"
epub |eng | 2021-07-24 | Author:Ken Youens-Clark [Ken Youens-Clark]
>>> rna = 'AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA' >>> aa = [] >>> for codon in [rna[n:n + 3] for n in range(0, len(rna), 3)]: ... aa.append(codon_to_aa[codon]) ... >>> aa ['M', 'A', 'M', 'A', ...
( Category:
other
May 28,2021 )
epub |eng | | Author:Gayathri Rajagopalan
pd.Timestamp('25 December 2000') pd.Timestamp('December 25 2000') pd.Timestamp('12/25/2000') pd.Timestamp('25-12-2000') pd.Timestamp(year=2000,month=12,day=25) pd.Timestamp('25-12-2000 12 PM') pd.Timestamp('25-12-2000 0:0.0') The pd.Timestamp function helps us define a date, time, and a combination of these two. However, ...
( Category:
other
May 27,2021 )
epub |eng | 2019-02-27 | Author:Fabrizio Romano [Fabrizio Romano]
( Category:
Python Programming
May 27,2021 )
pdf | | 2020-05-04 | Author:800+ pages of professional hints & tricks
( Category:
other
May 24,2021 )
epub |eng | 2021-05-15 | Author:Swati Saxena [Saxena, Swati]
What is PyCharm and wxPython?/p> Ans. Pycharm is an editor and integrated development environment by Jetbrains.com. Wxpython is a GUI library used for making GUI apps written in Python/C++. List ...
( Category:
Internet & Social Media
May 22,2021 )
Hot search:
Atomic Habits by James Clear harry potter Taboo Erotic python vampire The 48 Laws of Power by Robert Greene stephen king heated rivalry 1984 rachel reid warhammer atomic habits Erotica porn james patterson Gang freida mcfadden Electronics castle omnibus Breeding waters OMNIBUS the housemaid Lords Of The Underworld dune the very secret society of irregular witches The Knight Quests History of Rich Dad, Poor Dad by Robert T. Kiyosaki sex position business evaluation Rachel Reid music elle kennedy Daddy brandon sanderson the long game red rising Dresden Files predict zombie chess lonely planet soa Bang dan brown James Patterson
Atomic Habits by James Clear harry potter Taboo Erotic python vampire The 48 Laws of Power by Robert Greene stephen king heated rivalry 1984 rachel reid warhammer atomic habits Erotica porn james patterson Gang freida mcfadden Electronics castle omnibus Breeding waters OMNIBUS the housemaid Lords Of The Underworld dune the very secret society of irregular witches The Knight Quests History of Rich Dad, Poor Dad by Robert T. Kiyosaki sex position business evaluation Rachel Reid music elle kennedy Daddy brandon sanderson the long game red rising Dresden Files predict zombie chess lonely planet soa Bang dan brown James Patterson
Categories
Popular ebooks
