Search results for "Python"
pdf | | 2021-04-16 | Author:Unknown
( Category:
other
May 30,2021 )
pdf | | | Author:Unknown
( Category:
other
May 30,2021 )
pdf | | | Author:Unknown
( Category:
other
May 29,2021 )
pdf |en | | Author: Therese Hardin; Mathieu Jaume; Francois Pessaux; Veronique Viguie Donzeau-Gouge
( Category:
other
May 29,2021 )
epub |eng | 2021-07-24 | Author:Ken Youens-Clark [Ken Youens-Clark]
>>> rna = 'AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA' >>> aa = [] >>> for codon in [rna[n:n + 3] for n in range(0, len(rna), 3)]: ... aa.append(codon_to_aa[codon]) ... >>> aa ['M', 'A', 'M', 'A', ...
( Category:
other
May 28,2021 )
pdf | | 2021-05-23 | Author:Jason Test & Mark Broker [Test, Jason]
( Category:
other
May 27,2021 )
epub |eng | | Author:Brendan Choi
( Category:
Programming Languages
May 27,2021 )
epub |eng | | Author:Gayathri Rajagopalan
pd.Timestamp('25 December 2000') pd.Timestamp('December 25 2000') pd.Timestamp('12/25/2000') pd.Timestamp('25-12-2000') pd.Timestamp(year=2000,month=12,day=25) pd.Timestamp('25-12-2000 12 PM') pd.Timestamp('25-12-2000 0:0.0') The pd.Timestamp function helps us define a date, time, and a combination of these two. However, ...
( Category:
other
May 27,2021 )
epub |eng | 2019-02-27 | Author:Fabrizio Romano [Fabrizio Romano]
( Category:
Python Programming
May 27,2021 )
pdf | | 2015-03-24 | Author:Unknown
( Category:
other
May 26,2021 )
pdf | | 2015-10-23 | Author:Unknown
( Category:
other
May 26,2021 )
pdf | | | Author:Unknown
( Category:
other
May 26,2021 )
pdf | | 2020-05-04 | Author:800+ pages of professional hints & tricks
( Category:
other
May 24,2021 )
pdf | | 0101-01-01 | Author:Zamzar
( Category:
other
May 22,2021 )
Hot search:
nora roberts Rough Cold War for dummies Clyde Star Wars True crime stephen king heavy metal William w. Johnstone Python step by step Killer Potential Hannah Deitch chess James Patterson Manager python Clive Cussler Cassandra Dee artist Stalin health and family life education 2e workbook 2 harry potter anderle investment faq primary science for belize grade 1 students book Lynne graham martha wells james patterson reggae readers level 1 reader with mp3 audio file david wood China social studies for csec examinations 2nd edition upper secondary ebook pdf reggae readers level 2 reader with mp3 audio file Lenin Erotica 3d printing explore maths for jamaica grade 1 workbook brandon sanderson primary science for belize infant 1 workbook explore maths for jamaica grade 3 workbook health and family life education 2e students book 2 Kate Bold reggae readers level 3 reader with mp3 audio file dime 3rd ediction upper secondary ebook pdf Obsidian oecs secondary social studies grade 7 students book history for csec examinations students book 3 Solutions Manual
nora roberts Rough Cold War for dummies Clyde Star Wars True crime stephen king heavy metal William w. Johnstone Python step by step Killer Potential Hannah Deitch chess James Patterson Manager python Clive Cussler Cassandra Dee artist Stalin health and family life education 2e workbook 2 harry potter anderle investment faq primary science for belize grade 1 students book Lynne graham martha wells james patterson reggae readers level 1 reader with mp3 audio file david wood China social studies for csec examinations 2nd edition upper secondary ebook pdf reggae readers level 2 reader with mp3 audio file Lenin Erotica 3d printing explore maths for jamaica grade 1 workbook brandon sanderson primary science for belize infant 1 workbook explore maths for jamaica grade 3 workbook health and family life education 2e students book 2 Kate Bold reggae readers level 3 reader with mp3 audio file dime 3rd ediction upper secondary ebook pdf Obsidian oecs secondary social studies grade 7 students book history for csec examinations students book 3 Solutions Manual
Categories
Popular ebooks
